... ABA Valuation Data – By Type 45 Table Summary of < /b> IAS 38 100 Table FASB Intangible Asset Valuation Flowchart 150 Table Types of < /b> Intangibles – By Value 156 Table Differences Between IASs and < /b> AASBs ... reporting of < /b> intangible asset value at an enterprise level Intangible assets, lacking physical substance and < /b> defying the simple comparability analysis that physical form and < /b> attributes often facilitates, ... Legal and < /b> Accounting Standards Moving from the general inadequacy of < /b> prevailing valuation approaches as means for < /b> recognising the unique characteristics, and < /b> value, of < /b> intangible assets to deficiencies...
... a < /b> sense cDNA probe (complementary to the antisense) for < /b> mouse Slc1 2a2< /b> mRNA were designed as follows; Slc1 2a2< /b> antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2< /b> sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT ... that covered various portions of < /b> the promoter region (Fig 3A)< /b> The formation of < /b> a < /b> complex by Six1 was strongly competed by oligos 2, and < /b> for < /b> probe A,< /b> by oligos and < /b> for < /b> probe Band < /b> by oligos 6, and < /b> ... the binding of < /b> Six1 and < /b> probes A,< /b> Band < /b> C Oligo FEBS Journal 27 2 (20 05) 3 026 –3041 ª 20 05 FEBS Z-i Ando et al probe A < /b> probe A < /b> Target genes of < /b> Six1 and < /b> Six4 -97 +77 probe B+2 oligo oligo +75 -99...
... reported for < /b> the purification of < /b> a < /b> few other basic venom PLA2s [28 ] The enzymes are capable of < /b> inducing local edema (Fig 6) and < /b> are more potent anticoagulants than K49PLA2s (Table 4) A < /b> previous ... aggregation of < /b> platelet-rich plasma by purified PLA2 was measured with an aggregometer (model 60 0B; Payton, Scarbrough, Ont, Canada) at 37 °C after the addition of < /b> 10 lm ADP [4] The effects of < /b> PLA2s on blood ... of < /b> ADP-induced platelet aggregation by acidic E6-PLA2s or the weak basic G6< /b> -PLA2 from both venoms was also studied using platelet rich plasma prepared from human and < /b> rabbit blood Inhibition was...
... standardizing PTEN and < /b> Egr-1 mRNA Amplification primers were 5¢-ACCAGTGGCACTGTTGTTTCAC-3¢ and < /b> 5¢-TTCCTCTGGTCCTGGTATGAAG-3¢ for < /b> the PTEN gene [43], and < /b> 5¢-AGCCCTACGAGCACCTG-3¢ and < /b> 5¢-CGGTGGGTTGGTCATG-3¢ ... plasmids This work was supported by grants from The National Basic Research Program of < /b> China (20 05CB 522 404 and < /b> 20 06CB910506), The Program for < /b> Changjiang Scholars and < /b> Innovative Research Team ... blot analysis with rabbit polyclonal antibodies against PTEN (Abcam, Cambridge, MA, USA) or Egr-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and < /b> mouse monoclonal antibody against b- actin...
... Publishers, Dordrecht, The Netherlands, 20 02 S S Dragomir, R P Agarwal, and < /b> N S Barnett, “Inequalities for < /b> beta and < /b> gamma functions < /b> via some classical and < /b> new integral inequalities,” Journal of < /b> ... defined by 5 .2 and < /b> q is the corresponding kernel for < /b> the interval c, d Another representation for < /b> f < /b> : a,< /b> b × c, d → R is f < /b> x, y ba < /b> b d−c f < /b> t, y dt a < /b> ba < /b> d−c b d a < /b> c d c f < /b> x, s ds − ba < /b> d−c 2f < /b> t, ... dt a < /b> for < /b> x ∈ a,< /b> b , 5.1 F < /b> C Cˆrstea and < /b> S S Dragomir ı where p : a,< /b> b 11 → R is given by t a < /b> if a < /b> ≤ t ≤ x, t b p t, x if x < t ≤ b 5 .2 In the last decade, many authors see, e .g.< /b> , and < /b> the references...
... Publishers, Dordrecht, The Netherlands, 20 02 S S Dragomir, R P Agarwal, and < /b> N S Barnett, “Inequalities for < /b> beta and < /b> gamma functions < /b> via some classical and < /b> new integral inequalities,” Journal of < /b> ... defined by 5 .2 and < /b> q is the corresponding kernel for < /b> the interval c, d Another representation for < /b> f < /b> : a,< /b> b × c, d → R is f < /b> x, y ba < /b> b d−c f < /b> t, y dt a < /b> ba < /b> d−c b d a < /b> c d c f < /b> x, s ds − ba < /b> d−c 2f < /b> t, ... dt a < /b> for < /b> x ∈ a,< /b> b , 5.1 F < /b> C Cˆrstea and < /b> S S Dragomir ı where p : a,< /b> b 11 → R is given by t a < /b> if a < /b> ≤ t ≤ x, t b p t, x if x < t ≤ b 5 .2 In the last decade, many authors see, e .g.< /b> , and < /b> the references...
... formula may be understood as a < /b> formula for < /b> the ideal class number of < /b> Q( D), and < /b> the gate to the class number formula for < /b> arbitrary number fields opens up Special cases of < /b> Dirichlet’s class number formula ... many equivalence classes of < /b> binary forms of < /b> fixed discriminant D Associated with each form f < /b> is its group of < /b> automorphs containing all matrices αβ ∈ SL2 (Z) transforming f < /b> into itself The really ... doctorate of < /b> Gauß in G< /b> ttingen in 1849 Jacobi gave an interesting account of < /b> this event in a < /b> letter to o his brother ([Ah .2] , pp 22 7 22 8); for < /b> a < /b> general account see [Du], pp 27 5 27 9 Gauß was in an...
... data analysis and < /b> interpretation GS and < /b> LT were both responsible for < /b> the planning of < /b> the work and < /b> contributed to data analysis, interpretation, and < /b> write-up Acknowledgements We thank Mrs Birgitta ... statistical analysis The mean age at diagnosis of < /b> the patients was 40 years (range 10–83) and < /b> the mean disease duration was 16 years (range 1– 42) The mean Systemic Lupus International Collaborating ... haplotype DR3-DQ2C4AQ0, compared with 86% of < /b> the controls The frequencies of < /b> the FcγRIIa, FcγRIIIa, MBL, and < /b> IL-1Ra genotypes are displayed in Fig The FcγRIIa R/R, FcγRIIIa F/< /b> F, IL1Ra 2/ 2, and...
... surements of < /b> upper and < /b> lower leaf surfaces (Fig 2) For < /b> both clones and < /b> treatments, g < /b> shows its maximal value on sat s fully expanded leaves The optimal leaf ages were LPI for < /b> cv Beaupr6 and < /b> LPI 12 for < /b> ... sensitive to acid rain treatment than cv Robusta, as well for < /b> photosynthesis as for < /b> water vapor conductance Effects of < /b> treatment were statistically significant (P = 0.05) for < /b> cv Beaupr6, but not for < /b> cv ... Robusta On the whole, acid rain caused a < /b> decrease of < /b> stomatal conductance; g < /b> was reduced by 24 .0% for < /b> cv sat s Beaupr6 and < /b> by 15.4% for < /b> cv Robusta Acknowledgments This study was supported by...
... H3K27Ac NHEK Pol2 (b) Pol2 (a)< /b> (b) (c) HeLa AP- 2a < /b> Sig AP2 HeLa AP- 2g < /b> Sig AP2 HeLa c-Fos Sig c-Fos HeLa HeLa c-Myc Sig c-Myc HeLa3 Max Max Sig (d) HeLa Pol2 Sig Pol2 HeLa+IFN HeLa/Ig30 STAT STAT1 ... of < /b> California San Diego, 9500 Gilman Drive, La Jolla, CA 920 93, USA Authors’ contributions OH and < /b> VB performed the sequencing and < /b> statistical analysis GB and < /b> VB performed the rare variant analysis ... analysis of < /b> EC metabolites using the deuterated standards for < /b> AEA and < /b> 2- AG together with calculation of < /b> the other EC metabolites was based on a < /b> ratio to the deuterated standards and < /b> was performed...
... Transactions Information Warfare Infrastructure for < /b> Secure Information Transfer Standards and < /b> Protocols for < /b> Secure Information Transfer Network Design and < /b> Management Client/Server Computing E-commerce ... got off the ground and < /b> then was managed flawlessly by Matt and < /b> his professional team Many thanks to Matt and < /b> his team for < /b> keeping the project focused and < /b> maintaining its lively coverage Tamara ... Task Forces and < /b> the Federal Bureau of < /b> Investigation’s Infragard program Both initiatives bring together representatives from law enforcement, the private sector, and < /b> academia to share information...
... cortical and < /b> medullary sinuses and < /b> VEGF -A < /b> was ascertained to occur at interfaces - VEGF -A < /b> was present at the surface and < /b> inside reticular fibers (Fig 5. 2B) While the observation of < /b> VEGF -A < /b> within and < /b> ... MAb or a < /b> control rat IgG for < /b> weeks after immunization (Fig 6. 5A)< /b> Blood profiles for < /b> both NIMP-R14 MAb and < /b> control rat IgG-treated mice were performed on days 0, and < /b> 14 to assess depletion of < /b> ... lines demarcates lymphatics (B) Orthogonal plane view of < /b> how VEGF -A < /b> is aligned on the FRCs lining cortical and < /b> medullary sinuses Inset shows enlarged image of < /b> confocal image stack of < /b> boxed region...
... 120 ] v.v g< /b> i phương ngữ Nam B Như vậy, không gian đ a < /b> lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a < /b> lí phương ngữ Nam B xác đònh hẹp Ranh giới ... Việt + H Maspero, M.V Gordina I S Bustrov có quan điểm chia hai vùng phương ngữ: phương ngữ B c phương ngữ Trung (tiếng miền Nam giống phương ngữ B c) Hoàng Phê chia làm hai vùng ranh giới có khác: ... đề chung Nam B Nam B g< /b> m 19 tỉnh thành, chia thành hai khu vực: miền Đông Nam B (ĐNB) Đồng sông Cửu Long (ĐBSCL, g< /b> i Tây Nam B ) ĐNB g< /b> m tỉnh B R a < /b> - Vũng Tàu, Đồng Nai, B nh Dương, B nh Phước,...
... predicted DDGfo by Eqns (34) and < /b> (35) and < /b> experimental DDGfo for < /b> the training and < /b> test databases are shown Analysis of < /b> the importance of < /b> protein structural information for < /b> the numerical characterization ... a < /b> general set < /b> of < /b> data that consists of < /b> 53 A-< /b> mutants, with 28 of < /b> them having near wildtype stability ( 128 ) and < /b> the remainder being mutants with reduced stability (29 53) This set < /b> of < /b> data was randomly ... Calculated DDGfo by using PoPMuSiC algorithm compared to the experimental DDGfo for < /b> 44 Arc mutants Fig Calculated DDGfo by using Eqns (34) and < /b> (35) compared to the experimental DDGfo for < /b> 44 Arc...
... S-mapping generated by a < /b> finite family of < /b> nonexpansive mappings and < /b> real numbers as follows: Definition 2. 1 Let C be a < /b> nonempty convex subset of < /b> real Banach space Let {Ti }N be i=1 a < /b> finite family ... doi:10.1186/1687-18 12- 2011-38 Cite this article as: Kangtunyakarn: Iterative algorithms for < /b> finding a < /b> common solution of < /b> system of < /b> the set < /b> of < /b> variational inclusion problems and < /b> the set < /b> of < /b> fixed point problems Fixed ... the K-mapping generated by T1, T2, , Tn and < /b> l1, l2, , ln, and < /b> let K be the K-mapping generated by T1, T2, , and < /b> l1, l2, , i.e., Kx = lim Kn x n→∞ N for < /b> every x Î C Assume that F < /b> = ∞ F(< /b> Ti ) For...
... labour • Small companies say that their biggest issues are availability of < /b> capital and < /b> land, increasing production costs, and < /b> the cost of < /b> credit from VBARD (1.03% mth) Often they need to mortgage ... because the GSO gets reports on numbers of < /b> animals at Aug 1st, so they have no idea on how numbers change during the year Real data is ½ times higher than GSO data for < /b> animals (and < /b> milled feed?) ... associated with dealing with a < /b> bagged product – are affecting the sector • Need to think about the optimal scale for < /b> Vietnam animal feed industry – there could be a < /b> trade off between importing raw...
... said to have a < /b> uniformly Gateaux differentiable norm if for < /b> each y ∈ S, the limit 2. 1 converges uniformly for < /b> x ∈ S Further, X is said to be uniformly smooth if the limit 2. 1 exists uniformly for < /b> ... vol 52, no 1 -2, pp 134–1 42, 20 10 N Shioji and < /b> W Takahashi, “Strong convergence of < /b> approximated sequences for < /b> nonexpansive mappings in Banach spaces,” Proceedings of < /b> the American Mathematical Society, ... instead of < /b> μ a < /b> A < /b> mean μ on N is μn an We know that if μ is a < /b> Banach limit, then called a < /b> Banach limit if μn an lim inf an ≤ μ a < /b> ≤ lim sup an , n→∞ for < /b> every a < /b> 2. 5 n→∞ a1< /b> , a2< /b> , ∈ l∞ Thus, if...