0

440 karnaugh maps for a set of two functions a maps for f and g b 2 product map fo

Developing a set of legally compliant intangible asset valuation criteria and an equation supported TEV (total enterprise value) valuation approach

Developing a set of legally compliant intangible asset valuation criteria and an equation supported TEV (total enterprise value) valuation approach

Cao đẳng - Đại học

... ABA Valuation Data – By Type 45 Table Summary of < /b> IAS 38 100 Table FASB Intangible Asset Valuation Flowchart 150 Table Types of < /b> Intangibles – By Value 156 Table Differences Between IASs and < /b> AASBs ... reporting of < /b> intangible asset value at an enterprise level Intangible assets, lacking physical substance and < /b> defying the simple comparability analysis that physical form and < /b> attributes often facilitates, ... Legal and < /b> Accounting Standards Moving from the general inadequacy of < /b> prevailing valuation approaches as means for < /b> recognising the unique characteristics, and < /b> value, of < /b> intangible assets to deficiencies...
  • 410
  • 279
  • 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học

... a < /b> sense cDNA probe (complementary to the antisense) for < /b> mouse Slc1 2a2< /b> mRNA were designed as follows; Slc1 2a2< /b> antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2< /b> sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT ... that covered various portions of < /b> the promoter region (Fig 3A)< /b> The formation of < /b> a < /b> complex by Six1 was strongly competed by oligos 2, and < /b> for < /b> probe A,< /b> by oligos and < /b> for < /b> probe B and < /b> by oligos 6, and < /b> ... the binding of < /b> Six1 and < /b> probes A,< /b> B and < /b> C Oligo FEBS Journal 27 2 (20 05) 3 026 –3041 ª 20 05 FEBS Z-i Ando et al probe A < /b> probe A < /b> Target genes of < /b> Six1 and < /b> Six4 -97 +77 probe B +2 oligo oligo +75 -99...
  • 16
  • 476
  • 0
Báo cáo khoa học: Unusual venom phospholipases A2 of two primitive tree vipers Trimeresurus puniceus and Trimeresurus borneensis ppt

Báo cáo khoa học: Unusual venom phospholipases A2 of two primitive tree vipers Trimeresurus puniceus and Trimeresurus borneensis ppt

Báo cáo khoa học

... reported for < /b> the purification of < /b> a < /b> few other basic venom PLA2s [28 ] The enzymes are capable of < /b> inducing local edema (Fig 6) and < /b> are more potent anticoagulants than K49PLA2s (Table 4) A < /b> previous ... aggregation of < /b> platelet-rich plasma by purified PLA2 was measured with an aggregometer (model 60 0B; Payton, Scarbrough, Ont, Canada) at 37 °C after the addition of < /b> 10 lm ADP [4] The effects of < /b> PLA2s on blood ... of < /b> ADP-induced platelet aggregation by acidic E6-PLA2s or the weak basic G6< /b> -PLA2 from both venoms was also studied using platelet rich plasma prepared from human and < /b> rabbit blood Inhibition was...
  • 11
  • 477
  • 0
Báo cáo khoa học: Vitamin D stimulates apoptosis in gastric cancer cells in synergy with trichostatin A ⁄sodium butyrate-induced and 5-aza-2¢-deoxycytidine-induced PTEN upregulation ppt

Báo cáo khoa học: Vitamin D stimulates apoptosis in gastric cancer cells in synergy with trichostatin A ⁄sodium butyrate-induced and 5-aza-2¢-deoxycytidine-induced PTEN upregulation ppt

Báo cáo khoa học

... standardizing PTEN and < /b> Egr-1 mRNA Amplification primers were 5¢-ACCAGTGGCACTGTTGTTTCAC-3¢ and < /b> 5¢-TTCCTCTGGTCCTGGTATGAAG-3¢ for < /b> the PTEN gene [43], and < /b> 5¢-AGCCCTACGAGCACCTG-3¢ and < /b> 5¢-CGGTGGGTTGGTCATG-3¢ ... plasmids This work was supported by grants from The National Basic Research Program of < /b> China (20 05CB 522 404 and < /b> 20 06CB910506), The Program for < /b> Changjiang Scholars and < /b> Innovative Research Team ... blot analysis with rabbit polyclonal antibodies against PTEN (Abcam, Cambridge, MA, USA) or Egr-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and < /b> mouse monoclonal antibody against b- actin...
  • 11
  • 540
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Representation of Multivariate Functions via the Potential Theory and Applications to Inequalities'''' docx

Báo cáo khoa học

... Publishers, Dordrecht, The Netherlands, 20 02 S S Dragomir, R P Agarwal, and < /b> N S Barnett, “Inequalities for < /b> beta and < /b> gamma functions < /b> via some classical and < /b> new integral inequalities,” Journal of < /b> ... defined by 5 .2 and < /b> q is the corresponding kernel for < /b> the interval c, d Another representation for < /b> f < /b> : a,< /b> b × c, d → R is f < /b> x, y b a < /b> b d−c f < /b> t, y dt a < /b> b a < /b> d−c b d a < /b> c d c f < /b> x, s ds − b a < /b> d−c 2 f < /b> t, ... dt a < /b> for < /b> x ∈ a,< /b> b , 5.1 F < /b> C Cˆrstea and < /b> S S Dragomir ı where p : a,< /b> b 11 → R is given by t a < /b> if a < /b> ≤ t ≤ x, t b p t, x if x < t ≤ b 5 .2 In the last decade, many authors see, e .g.< /b> , and < /b> the references...
  • 15
  • 267
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Representation of Multivariate Functions via the Potential Theory and Applications to Inequalities" ppt

Báo cáo khoa học

... Publishers, Dordrecht, The Netherlands, 20 02 S S Dragomir, R P Agarwal, and < /b> N S Barnett, “Inequalities for < /b> beta and < /b> gamma functions < /b> via some classical and < /b> new integral inequalities,” Journal of < /b> ... defined by 5 .2 and < /b> q is the corresponding kernel for < /b> the interval c, d Another representation for < /b> f < /b> : a,< /b> b × c, d → R is f < /b> x, y b a < /b> b d−c f < /b> t, y dt a < /b> b a < /b> d−c b d a < /b> c d c f < /b> x, s ds − b a < /b> d−c 2 f < /b> t, ... dt a < /b> for < /b> x ∈ a,< /b> b , 5.1 F < /b> C Cˆrstea and < /b> S S Dragomir ı where p : a,< /b> b 11 → R is given by t a < /b> if a < /b> ≤ t ≤ x, t b p t, x if x < t ≤ b 5 .2 In the last decade, many authors see, e .g.< /b> , and < /b> the references...
  • 15
  • 288
  • 0
Analytic Number Theory A Tribute to Gauss and Dirichlet Part 2 pdf

Analytic Number Theory A Tribute to Gauss and Dirichlet Part 2 pdf

Kĩ thuật Viễn thông

... formula may be understood as a < /b> formula for < /b> the ideal class number of < /b> Q( D), and < /b> the gate to the class number formula for < /b> arbitrary number fields opens up Special cases of < /b> Dirichlet’s class number formula ... many equivalence classes of < /b> binary forms of < /b> fixed discriminant D Associated with each form f < /b> is its group of < /b> automorphs containing all matrices αβ ∈ SL2 (Z) transforming f < /b> into itself The really ... doctorate of < /b> Gauß in G< /b> ttingen in 1849 Jacobi gave an interesting account of < /b> this event in a < /b> letter to o his brother ([Ah .2] , pp 22 7 22 8); for < /b> a < /b> general account see [Du], pp 27 5 27 9 Gauß was in an...
  • 20
  • 333
  • 0
Báo cáo y học:

Báo cáo y học: "Analysis of HLA DR, HLA DQ, C4A, FcγRIIa, FcγRIIIa, MBL, and IL-1Ra allelic variants in Caucasian systemic lupus erythematosus patients suggests an effect of the combined FcγRIIa R/R and IL-1Ra 2/2 genotypes on disease susceptibility" pptx

Báo cáo khoa học

... data analysis and < /b> interpretation GS and < /b> LT were both responsible for < /b> the planning of < /b> the work and < /b> contributed to data analysis, interpretation, and < /b> write-up Acknowledgements We thank Mrs Birgitta ... statistical analysis The mean age at diagnosis of < /b> the patients was 40 years (range 10–83) and < /b> the mean disease duration was 16 years (range 1– 42) The mean Systemic Lupus International Collaborating ... haplotype DR3-DQ2C4AQ0, compared with 86% of < /b> the controls The frequencies of < /b> the FcγRIIa, FcγRIIIa, MBL, and < /b> IL-1Ra genotypes are displayed in Fig The FcγRIIa R/R, FcγRIIIa F/< /b> F, IL1Ra 2/ 2, and...
  • 6
  • 292
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Direct effects of acidic wet deposition on photosynthesis and stomatal conductance of two Populus clones (P. cv. Beaupré and P. cv. Robusta" pot

Báo cáo khoa học

... surements of < /b> upper and < /b> lower leaf surfaces (Fig 2) For < /b> both clones and < /b> treatments, g < /b> shows its maximal value on sat s fully expanded leaves The optimal leaf ages were LPI for < /b> cv Beaupr6 and < /b> LPI 12 for < /b> ... sensitive to acid rain treatment than cv Robusta, as well for < /b> photosynthesis as for < /b> water vapor conductance Effects of < /b> treatment were statistically significant (P = 0.05) for < /b> cv Beaupr6, but not for < /b> cv ... Robusta On the whole, acid rain caused a < /b> decrease of < /b> stomatal conductance; g < /b> was reduced by 24 .0% for < /b> cv sat s Beaupr6 and < /b> by 15.4% for < /b> cv Robusta Acknowledgments This study was supported by...
  • 4
  • 160
  • 0
Báo cáo y học:

Báo cáo y học: "Population sequencing of two endocannabinoid metabolic genes identifies rare and common regulatory variants associated with extreme obesity and metabolite level" doc

Báo cáo khoa học

... H3K27Ac NHEK Pol2 (b) Pol2 (a)< /b> (b) (c) HeLa AP- 2a < /b> Sig AP2 HeLa AP- 2g < /b> Sig AP2 HeLa c-Fos Sig c-Fos HeLa HeLa c-Myc Sig c-Myc HeLa3 Max Max Sig (d) HeLa Pol2 Sig Pol2 HeLa+IFN HeLa/Ig30 STAT STAT1 ... of < /b> California San Diego, 9500 Gilman Drive, La Jolla, CA 920 93, USA Authors’ contributions OH and < /b> VB performed the sequencing and < /b> statistical analysis GB and < /b> VB performed the rare variant analysis ... analysis of < /b> EC metabolites using the deuterated standards for < /b> AEA and < /b> 2- AG together with calculation of < /b> the other EC metabolites was based on a < /b> ratio to the deuterated standards and < /b> was performed...
  • 18
  • 354
  • 0
FUNCTIONAL ANALYSIS OF TWO NOVEL DNA REPAIR FACTORS, METNASE AND PSO4

FUNCTIONAL ANALYSIS OF TWO NOVEL DNA REPAIR FACTORS, METNASE AND PSO4

Y khoa - Dược

... same 54-bp nucleotides (Fwd-Rev template: 5'-AGG TTG GTG CAA AAG TAA TTG CGG AGC TGG CTA TCG GAA CTC TCG GAA GTT GGG TCA GTT ACA ACG CGC CAC CCG CGC CCC GTA CTG ATA GCA GGG CGT TAA TGA AAA CGT ... TAA TTG CGG AGC TGG CTA TCG GAA CTC TCG GAA GTT GGG TCA GTT ACA ACG CGC CAC CCG CGC CCC GTA CTG ATA GCA GGG CGT TAA TGA AAA CGT GGA GGT T-3') were annealed For < /b> Metnase-induced DNA looping experiments, ... CTA TCG GAA CTC TCG GAA GTT GGG TCA GTT ACA ACG CGC CAC CCG CGC CCC GTA CTG ATA GCA GGG TGC AAA AGT AAT TGC GGA GGT T-3') or a < /b> forward TIR 32 sequence and < /b> a < /b> reverse TIR 32 sequence separated by the...
  • 114
  • 135
  • 0
HANDBOOK OF INFORMATION SECURITY Threats, Vulnerabilities, Prevention,Detection, and Management Volume 2

HANDBOOK OF INFORMATION SECURITY Threats, Vulnerabilities, Prevention,Detection, and Management Volume 2

Chứng chỉ quốc tế

... Transactions Information Warfare Infrastructure for < /b> Secure Information Transfer Standards and < /b> Protocols for < /b> Secure Information Transfer Network Design and < /b> Management Client/Server Computing E-commerce ... got off the ground and < /b> then was managed flawlessly by Matt and < /b> his professional team Many thanks to Matt and < /b> his team for < /b> keeping the project focused and < /b> maintaining its lively coverage Tamara ... Task Forces and < /b> the Federal Bureau of < /b> Investigation’s Infragard program Both initiatives bring together representatives from law enforcement, the private sector, and < /b> academia to share information...
  • 1,008
  • 1,327
  • 0
Mechanisms and functions of lymphangiogenesis in regulating the immune response and inflammation resolution 2

Mechanisms and functions of lymphangiogenesis in regulating the immune response and inflammation resolution 2

Y - Dược

... cortical and < /b> medullary sinuses and < /b> VEGF -A < /b> was ascertained to occur at interfaces - VEGF -A < /b> was present at the surface and < /b> inside reticular fibers (Fig 5. 2B) While the observation of < /b> VEGF -A < /b> within and < /b> ... MAb or a < /b> control rat IgG for < /b> weeks after immunization (Fig 6. 5A)< /b> Blood profiles for < /b> both NIMP-R14 MAb and < /b> control rat IgG-treated mice were performed on days 0, and < /b> 14 to assess depletion of < /b> ... lines demarcates lymphatics (B) Orthogonal plane view of < /b> how VEGF -A < /b> is aligned on the FRCs lining cortical and < /b> medullary sinuses Inset shows enlarged image of < /b> confocal image stack of < /b> boxed region...
  • 135
  • 336
  • 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

Khoa học xã hội

... 120 ] v.v g< /b> i phương ngữ Nam B Như vậy, không gian đ a < /b> lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a < /b> lí phương ngữ Nam B xác đònh hẹp Ranh giới ... Việt + H Maspero, M.V Gordina I S Bustrov có quan điểm chia hai vùng phương ngữ: phương ngữ B c phương ngữ Trung (tiếng miền Nam giống phương ngữ B c) Hoàng Phê chia làm hai vùng ranh giới có khác: ... đề chung Nam B Nam B g< /b> m 19 tỉnh thành, chia thành hai khu vực: miền Đông Nam B (ĐNB) Đồng sông Cửu Long (ĐBSCL, g< /b> i Tây Nam B ) ĐNB g< /b> m tỉnh B R a < /b> - Vũng Tàu, Đồng Nai, B nh Dương, B nh Phước,...
  • 137
  • 853
  • 0
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

Báo cáo khoa học

... predicted DDGfo by Eqns (34) and < /b> (35) and < /b> experimental DDGfo for < /b> the training and < /b> test databases are shown Analysis of < /b> the importance of < /b> protein structural information for < /b> the numerical characterization ... a < /b> general set < /b> of < /b> data that consists of < /b> 53 A-< /b> mutants, with 28 of < /b> them having near wildtype stability ( 128 ) and < /b> the remainder being mutants with reduced stability (29 53) This set < /b> of < /b> data was randomly ... Calculated DDGfo by using PoPMuSiC algorithm compared to the experimental DDGfo for < /b> 44 Arc mutants Fig Calculated DDGfo by using Eqns (34) and < /b> (35) compared to the experimental DDGfo for < /b> 44 Arc...
  • 29
  • 406
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Iterative algorithms for finding a common solution of system of the set of variational inclusion problems and the set of fixed point problems" potx

Hóa học - Dầu khí

... S-mapping generated by a < /b> finite family of < /b> nonexpansive mappings and < /b> real numbers as follows: Definition 2. 1 Let C be a < /b> nonempty convex subset of < /b> real Banach space Let {Ti }N be i=1 a < /b> finite family ... doi:10.1186/1687-18 12- 2011-38 Cite this article as: Kangtunyakarn: Iterative algorithms for < /b> finding a < /b> common solution of < /b> system of < /b> the set < /b> of < /b> variational inclusion problems and < /b> the set < /b> of < /b> fixed point problems Fixed ... the K-mapping generated by T1, T2, , Tn and < /b> l1, l2, , ln, and < /b> let K be the K-mapping generated by T1, T2, , and < /b> l1, l2, , i.e., Kx = lim Kn x n→∞ N for < /b> every x Î C Assume that F < /b> = ∞ F(< /b> Ti ) For...
  • 16
  • 309
  • 0
Báo cáo khoa học nông nghiệp

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed - Milestone 4 " ppt

Báo cáo khoa học

... labour • Small companies say that their biggest issues are availability of < /b> capital and < /b> land, increasing production costs, and < /b> the cost of < /b> credit from VBARD (1.03% mth) Often they need to mortgage ... because the GSO gets reports on numbers of < /b> animals at Aug 1st, so they have no idea on how numbers change during the year Real data is ½ times higher than GSO data for < /b> animals (and < /b> milled feed?) ... associated with dealing with a < /b> bagged product – are affecting the sector • Need to think about the optimal scale for < /b> Vietnam animal feed industry – there could be a < /b> trade off between importing raw...
  • 5
  • 533
  • 0
báo cáo hóa học:

báo cáo hóa học:" Research Article Iterative Methods for Variational Inequalities over the Intersection of the Fixed Points Set of a Nonexpansive Semigroup in Banach Spaces" pot

Hóa học - Dầu khí

... said to have a < /b> uniformly Gateaux differentiable norm if for < /b> each y ∈ S, the limit 2. 1 converges uniformly for < /b> x ∈ S Further, X is said to be uniformly smooth if the limit 2. 1 exists uniformly for < /b> ... vol 52, no 1 -2, pp 134–1 42, 20 10 N Shioji and < /b> W Takahashi, “Strong convergence of < /b> approximated sequences for < /b> nonexpansive mappings in Banach spaces,” Proceedings of < /b> the American Mathematical Society, ... instead of < /b> μ a < /b> A < /b> mean μ on N is μn an We know that if μ is a < /b> Banach limit, then called a < /b> Banach limit if μn an lim inf an ≤ μ a < /b> ≤ lim sup an , n→∞ for < /b> every a < /b> 2. 5 n→∞ a1< /b> , a2< /b> , ∈ l∞ Thus, if...
  • 17
  • 354
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Use of flow cytometry to develop and characterize a set of monoclonal antibodies specific for rabbit leukocyte differentiation molecules" ppsx

Báo cáo khoa học

... IgG1 IgG1 IgG1 IgM IgG 2a < /b> IgG1 IgG1 IgM IgM IgG1 IgG1 IgM IgM IgM IgM IgM IgM IgM IgM IgM IgG1 IgM IgG1 IgG3 IgG 2a < /b> IgG1 IgG1 IgG1 IgM IgM IgG1 IgG1 IgG 2a < /b> IgG1 IgG1 IgG3 IgG 2a < /b> IgG 2a < /b> Specificity ... MRB10 7A < /b> MRB10 2A < /b> RTH18 6A < /b> RH 1A < /b> LT8 6A < /b> RACT4 8A < /b> HUH7 3A < /b> RTH16 1A < /b> RT1 8A < /b> RT 3A < /b> CAM3 6A < /b> H2 0A < /b> HUH8 2A < /b> BAQ3 0A < /b> 25 - 32 BAG4 0A < /b> LT4 1A < /b> ISC1 8A < /b> Ig isotype IgG 2a < /b> IgG 2a < /b> IgG 2a < /b> IgG 2a < /b> IgG1 IgG1 IgG1 IgM IgG1 IgG 2a < /b> IgM IgG1 ... RTH 2A < /b> RTH23 0A < /b> RTH2 1A < /b> RT2 2A < /b> MRB6 1A < /b> RTH2 6A < /b> RTH6 5A < /b> RACT5 3A < /b> RTH 1A < /b> RTH19 2A < /b> ISC1 6A < /b> ISC2 7A < /b> ISC29E ISC3 8A < /b> RT 1A < /b> RACT1 9A < /b> RACT2 0A < /b> MRB 12 0A < /b> RACT1 4A < /b> RACT2 1A < /b> RACT3 0A < /b> MRB2 5A < /b> MRB2 9A < /b> MRB14 3A < /b> BAQ4 4A < /b> CADO3 4A < /b> RT19A...
  • 16
  • 365
  • 0

Xem thêm